*Usecase2*: Difference between revisions

From referenceTSS
Jump to: navigation, search
m (1st round noise removing)
No edit summary
 
(6 intermediate revisions by the same user not shown)
Line 1: Line 1:
<nowiki> </nowiki>
== TSS data processing and differential analysis using refTSS  ==
== TSS data processing and differential analysis using refTSS  ==
This tutorial provides step by step workflow to achive gold standard expression analysis using refTSS, and obtains TSS expression table, input TSSID list for refTSS-LD, quality assessment of TSS sequencing and statistical testing results. These scripts are based on the scripts written in [[Source::https://pubmed.ncbi.nlm.nih.gov/32124327/|Morioka MS et al.]].
This tutorial provides step by step workflow to achive gold standard expression analysis using refTSS, and obtains TSS expression table, input TSSID list for refTSS-LD, quality assessment of TSS sequencing and statistical testing results. These scripts are based on the scripts written in [[Source::https://pubmed.ncbi.nlm.nih.gov/32124327/|Morioka MS et al.]].


Line 35: Line 36:


* [[Source::https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_46/gencode.v46.annotation.gtf.gz|hg38 gene annotation]]
* [[Source::https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_46/gencode.v46.annotation.gtf.gz|hg38 gene annotation]]
 
<pre>
* <pre>
   ## .genome file creation
   ## .genome file creation
   pip install --upgrade pip
   pip install --upgrade pip
Line 42: Line 42:
   gzip -d GRCh38.p14.genome.fa.gz
   gzip -d GRCh38.p14.genome.fa.gz
   faidx GRCh38.p14.genome.fa -i chromsizes >GRCh38.p14.genome
   faidx GRCh38.p14.genome.fa -i chromsizes >GRCh38.p14.genome
* </pre>
</pre>


=== 1.2 [Optional] Download fastq files from NCBI SRA ===
=== 1.2 Download fastq files from NCBI SRA ===


Downloading an example data set (CAGE data) for test run.
Downloading an example data set (CAGE data) for test run.


* <pre>
<pre>
   fasterq-dump DRR159241 -o mutA_rep1.fq -e 12 -p
   fasterq-dump DRR159241 -o mutA_rep1.fq -e 12 -p
   fasterq-dump DRR159242 -o mutA_rep2.fq -e 12 -p
   fasterq-dump DRR159242 -o mutA_rep2.fq -e 12 -p
Line 55: Line 55:
   fasterq-dump DRR159245 -o wt_rep2.fq -e 12 -p
   fasterq-dump DRR159245 -o wt_rep2.fq -e 12 -p
   fasterq-dump DRR159246 -o wt_rep3.fq -e 12 -p
   fasterq-dump DRR159246 -o wt_rep3.fq -e 12 -p
*</pre>
</pre>


=== Sequencing quality check by Phread scale ===
=== Sequencing quality check by Phread scale ===
Line 148: Line 148:


<pre>
<pre>
wt_rep1Aligned.sortedByCoord.out.240925.ctss.txt
- wt_rep1Aligned.sortedByCoord.out.240925.ctss.txt
wt_rep2Aligned.sortedByCoord.out.240925.ctss.txt
- wt_rep2Aligned.sortedByCoord.out.240925.ctss.txt
wt_rep3Aligned.sortedByCoord.out.240925.ctss.txt
- wt_rep3Aligned.sortedByCoord.out.240925.ctss.txt
mutA_rep1Aligned.sortedByCoord.out.240925.ctss.txt
- mutA_rep1Aligned.sortedByCoord.out.240925.ctss.txt
mutA_rep2Aligned.sortedByCoord.out.240925.ctss.txt
- mutA_rep2Aligned.sortedByCoord.out.240925.ctss.txt
mutA_rep3Aligned.sortedByCoord.out.240925.ctss.txt
- mutA_rep3Aligned.sortedByCoord.out.240925.ctss.txt
</pre>
</pre>


Line 173: Line 173:
Here is the example output `TSS.qcbarplot.pdf` from result of test data set.
Here is the example output `TSS.qcbarplot.pdf` from result of test data set.


[[File:https://github.com/user-attachments/assets/b2e24f78-4d05-4135-bf30-957ab7389178|thumb|alt=tsstagqc|width=1020px]]
<html>
<p style="text-align: center;"><img src="https://github.com/user-attachments/assets/b2e24f78-4d05-4135-bf30-957ab7389178" alt="image-tssqcplot" style="zoom:40%;"></p>
</html>




Line 179: Line 181:
== 4. Differential expression analysis of TSS sequencing using refTSS ==
== 4. Differential expression analysis of TSS sequencing using refTSS ==


TSS tags will be useful for gene expression analysis. Caculating TSS tag counts on refTSS as well as GENCODE promoter, will provide TSS-wide comprehensive view of expression changes in the genome.
TSS tags will be useful for gene expression analysis. Calculating TSS tag counts on refTSS will provide TSS-wide comprehensive view of expression changes in the genome.


==== Making directory for this analysis ====
==== Making directory for this analysis ====
Line 222: Line 224:
load("cage_count{date}.RData")
load("cage_count{date}.RData")


= R object list =
# R object list  
> ls()
> ls()
  [1] "args"      "cname"      "d"          "df"        "dgeL"       
  [1] "args"      "cname"      "d"          "df"        "dgeL"       
Line 272: Line 274:
   abline(h=0,col="tan4")
   abline(h=0,col="tan4")
dev.off()
dev.off()
<pre>
</pre>
 
[[File:https://github.com/user-attachments/assets/7c3aa90f-dd60-4520-a514-57a32501c828|thumb|alt=maplot_2024-09-26 21 17 46|width=880px]]
 


<html>
<p style="text-align: center;"><img src="https://github.com/user-attachments/assets/7c3aa90f-dd60-4520-a514-57a32501c828" style="zoom:40%;"></p>
</html>


== Reference ==
== Reference ==

Latest revision as of 19:38, 27 September 2024

TSS data processing and differential analysis using refTSS

This tutorial provides step by step workflow to achive gold standard expression analysis using refTSS, and obtains TSS expression table, input TSSID list for refTSS-LD, quality assessment of TSS sequencing and statistical testing results. These scripts are based on the scripts written in Morioka MS et al..

For hands on tutorial, refTSS provides an example data-set published by Yasukawa et al. at use-case file folder:


Software Requirements

  • NCBI tools (for fastq file download)
  • bigWigAverageOverBed, bedGraphToBigWig in Jim Kent Utility tools
 http://genome-test.cse.ucsc.edu/~kent/exe/
  • fastqc program
  • cutadapt
  • STAR
  • R (version 4.2.2 or later)
 https://www.r-project.org/
  • BEDtools (Confirmed to work with version 2.28 and version 2.29)
 http://code.google.com/p/bedtools/



1. FASTQ preparation

Download genome reference files

GRCh38 human genome assembly files

   ## .genome file creation
   pip install --upgrade pip
   pip install pyfaidx
   gzip -d GRCh38.p14.genome.fa.gz
   faidx GRCh38.p14.genome.fa -i chromsizes >GRCh38.p14.genome

1.2 Download fastq files from NCBI SRA

Downloading an example data set (CAGE data) for test run.

  fasterq-dump DRR159241 -o mutA_rep1.fq -e 12 -p
  fasterq-dump DRR159242 -o mutA_rep2.fq -e 12 -p
  fasterq-dump DRR159243 -o mutA_rep3.fq -e 12 -p
  fasterq-dump DRR159244 -o wt_rep1.fq -e 12 -p
  fasterq-dump DRR159245 -o wt_rep2.fq -e 12 -p
  fasterq-dump DRR159246 -o wt_rep3.fq -e 12 -p

Sequencing quality check by Phread scale

fastqc -o qc_mutA_rep1 mutA_rep1.fq
fastqc -o qc_mutA_rep2 mutA_rep2.fq
fastqc -o qc_mutA_rep3 mutA_rep3.fq
fastqc -o qc_wt_rep1 wt_rep1.fq
fastqc -o qc_wt_rep2 wt_rep2.fq
fastqc -o qc_wt_rep3 wt_rep3.fq


[Optional] Adaptor trimiming step (e.g., two color illumina chemistries)

One of the major sequecing techs are both NextSeq and the NovaSeq which uses two-colored chemisty. In this case, 3'-end of `G` was derived from end of sequencing with good sequence quality. cutadapt with `--nextseq-trim=20` option will work as regular quality trimming (where one would use `-q 20` instead), except that the qualities of 3'-end `G` bases are ignored.

# -m: minimum output read length 
# -a: adaptor trimming 
# Trueseq read1 adaptor sequence:AGATCGGAAGAGCACACGTCTGAACTCCAGTCA 
# Nextra adaptor sequence: CTGTCTCTTATACACATCT 
# --nextseq-trim=20  
cutadapt -m 30 --nextseq-trim=20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -o mutA_rep1.tm.fq mutA_rep1.fq
cutadapt -m 30 --nextseq-trim=20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -o mutA_rep2.tm.fq mutA_rep2.fq
cutadapt -m 30 --nextseq-trim=20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -o mutA_rep3.tm.fq mutA_rep3.fq
cutadapt -m 30 --nextseq-trim=20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -o wt_rep1.tm.fq wt_rep1.fq
cutadapt -m 30 --nextseq-trim=20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -o wt_rep2.tm.fq wt_rep2.fq
cutadapt -m 30 --nextseq-trim=20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -o wt_rep3.tm.fq wt_rep3.fq

2. Mapping TSS seq reads

# STAR genome index generation 

STAR --runMode genomeGenerate \
	--genomeDir GRCh38p14_star_index \
	--runThreadN 16 \
	--genomeFastaFiles GRCh38.p14.genome.fa \
	--sjdbGTFfile gencode.v46.annotation.gtf


# STAR Mapping with example options 
GTF=/home/masaki.morioka/genome/gencode.v46.annotation.gtf
SGENOME=/home/masaki.m/genome/GRCh38p14_star_index
_naming=mutA_rep1

STAR --runThreadN 12 --genomeDir $SGENOME \
		--readFilesIn ${_naming}.tm.fq \
		--outSAMtype BAM SortedByCoordinate \
		--outTmpKeep None \
	  --outFileNamePrefix ${_naming}



3. CTSS file generation and quality assessment of TSS sequencing

3.1 Download and excuting the Shell Script for TSS tag count table

Download the shellscript for counting TSS tags and the reference of canonical TSS coordinates (GENCODE)

# Download scripts from Github #
git clone https://github.com/suimye/cage_tutorial.git
chmod 755 ./cage_tutorial/*

# Download canonical promoter coordinates (e.g., GENCODE) 
wget https:://refTSS.riken.jp/tutorial/gencode.v40.promoter300-100.bed.gz 
gzip -d gencode.v40.promoter300-100.bed.gz 

# Making a directory for tag count result 
mkdir gencode_count
cd gencode_count/

Running the script for tag counting

# Example: bash cage.counting.pipeline.b0.01.sh {sample.bam} {mapping quality (integer)} {referece.bed} {genome size file} =
sh ../cage_tutorial/cage.counting.pipeline.b0.01.sh ../mutA_rep1Aligned.sortedByCoord.out.bam 20 gencode.v40.promoter300-100.bed ../GRCh38.p14.genome
-----

Following six tag count files are generated.

- wt_rep1Aligned.sortedByCoord.out.240925.ctss.txt
- wt_rep2Aligned.sortedByCoord.out.240925.ctss.txt
- wt_rep3Aligned.sortedByCoord.out.240925.ctss.txt
- mutA_rep1Aligned.sortedByCoord.out.240925.ctss.txt
- mutA_rep2Aligned.sortedByCoord.out.240925.ctss.txt
- mutA_rep3Aligned.sortedByCoord.out.240925.ctss.txt


3.2 TSS Quality Evaluation and Create Expression Tables Using R

TSS sequencing technologies are expected to enrich TSS infomation from sequencing reads. Yield of tags should be overlapped with canonical TSS annotation such as 5 prime end of GENCODE mRNA annotation.

The script `promoter_mapping_rate.R` reads the files ending with `ctss.txt` generated in the previous process and creates an expression data table. Be careful not to have any unnecessary `ctss.txt` files in your working folder as it may cause errors. After the args option, enter the labels for the comparison groups (in this case, WT and Mutant) separated by spaces. These input labels will use for regular expression of file names. If you specify "none" for the `--args` option, it is used when you want to simply create an expression data table without considering replicate experiments.

= Generating normalized data for two groups using RLE normalization in edgeR  =
R --slave --vanilla --args wt mutA < ../cage_tutorial/promoter_mapping_rate.b0.2.R
= simply generating the TSS tag count matrix =
R --slave --vanilla --args none  < ../cage_tutorial/promoter_mapping_rate.b0.2.R 

Here is the example output `TSS.qcbarplot.pdf` from result of test data set.

image-tssqcplot


4. Differential expression analysis of TSS sequencing using refTSS

TSS tags will be useful for gene expression analysis. Calculating TSS tag counts on refTSS will provide TSS-wide comprehensive view of expression changes in the genome.

Making directory for this analysis

# make new directory 
cd ../
mkdir reftss_count
cd reftss_count
# download refTSS human corrdinate file 
wget https://reftss.riken.jp/datafiles/4.1/human/refTSS_v4.1_human_coordinate.hg38.bed.txt.gz
gzip -d refTSS_v4.1_human_coordinate.hg38.bed.txt.gz

Calculation of TSS tag counts on refTSS

# Example: bash cage.counting.pipeline.b0.02.sh {sample.bam} {mapping quality (integer)} {referece.bed} {genome size file} =

sh ../cage_tutorial/cage.counting.pipeline.b0.02.sh ../mutA_rep1Aligned.sortedByCoord.out.bam 20 refTSS_v4.1_human_coordinate.hg38.bed.txt ../GRCh38.p14.genome
sh ../cage_tutorial/cage.counting.pipeline.b0.02.sh ../mutA_rep2Aligned.sortedByCoord.out.bam 20 refTSS_v4.1_human_coordinate.hg38.bed.txt ../GRCh38.p14.genome
sh ../cage_tutorial/cage.counting.pipeline.b0.02.sh ../mutA_rep3Aligned.sortedByCoord.out.bam 20 refTSS_v4.1_human_coordinate.hg38.bed.txt ../GRCh38.p14.genome
sh ../cage_tutorial/cage.counting.pipeline.b0.02.sh ../wt_rep1Aligned.sortedByCoord.out.bam 20 refTSS_v4.1_human_coordinate.hg38.bed.txt ../GRCh38.p14.genome
sh ../cage_tutorial/cage.counting.pipeline.b0.02.sh ../wt_rep2Aligned.sortedByCoord.out.bam 20 refTSS_v4.1_human_coordinate.hg38.bed.txt ../GRCh38.p14.genome
sh ../cage_tutorial/cage.counting.pipeline.b0.02.sh ../wt_rep3Aligned.sortedByCoord.out.bam 20 refTSS_v4.1_human_coordinate.hg38.bed.txt ../GRCh38.p14.genome

Making TSS expression matrix in R environment

R --slave --vanilla --args wt mutA < ../cage_tutorial/promoter_mapping_rate.b0.2.R

After execution of previous command, R data file was created as `cage_count{date}.RData`

4.1 Statistical testing and MA-plot

Processing data and statistical testing are conductedon R environment.

library(edgeR)
load("cage_count{date}.RData")

# R object list 
> ls()
 [1] "args"       "cname"      "d"          "df"         "dgeL"      
 [6] "fl"         "flag"       "gp"         "gp1"        "gp2"       
[11] "i"          "log2cpm"    "read_d"     "rname"      "size"      
[16] "time_stamp"

# Statistical testing by exact test 
et_res <- exactTest(dgeL)

# Extraction of top 100 TSSs by statistics (p-value, FDR) 
detss <- topTags(et_res,n=100,adjust.method="BH",sort.by="Pvalue",p.value=0.0001)

# Dividing up- and down-regulated TSS list 
de_up <- subset(detss$table,logFC>0)
de_down <- subset(detss$table,logFC<0)

4.2 TSS ID list preparation for GWAS-LD enrichment analysis

To prepare input for GWAS-LD enrichment analysis, TSS ID lists were restored in working directory. GWAS-LD enrichment analysis introduced in here.

# This process removes double quotation and line numbers from rowname vectors. 

# upregulated list
sink("up_det.list.txt")
  cat(rownames(de_up), sep = "\n") 
sink() 


# downregulated list
sink("down_det.list.txt")
  cat(rownames(de_down), sep = "\n") 
sink() 


4.3 Visualization of differential expression by MA-plot

One of the standard approaches on visualization of expression value is MA-plot showing relationship between average expression and fold difference in each genes (or TSSs). Here is an example of MA-plot using test data.

pdf("maplot.pdf")
  plot(et_res$table$logCPM,et_res$table$logFC,cex=0.3,pch=16,col="darkgrey",xlab="Average log-expression",ylab="Expression log-ratio (MutA vs WT)")
  points(de_up$logCPM,de_up$logFC,cex=0.7,pch=16,col="deeppink")
  points(de_down$logCPM,de_down$logFC,cex=0.7,pch=16,col="steelblue")
  abline(h=0,col="tan4")
dev.off()

Reference

  • Script: Morioka MS et al. Methods Mol Biol. 2020:2120:277-301. doi:10.1007/978-1-0716-0327-7_20.
  • Example dataset: Yasukawa et al. Nat Commun. 2020:11:1557, doi:10.1038/s41457-020. 15289-7
  • edgeR DOI:10.18129/B9.bioc.edgeR
  • Kent Util tool: https://hgdownload.soe.ucsc.edu/admin/exe
  • BEDtools: Quinlan AR and Hall IM Bioinformatics. 2010:26, 6, pp. 841–842.
  • FASTQC: Wingett SW, Andrews S. et al. 2018 doi:10.12688/f1000research.15931.2. eCollection
  • STAR: Dobin A et al. Bioinformatics 2013:29(1):15-21. doi:10.1093/bioinformatics/bts635. Epub 2012 Oct 25.
  • Cutadapt: Marcel Martin doi:10.14806/ej.17.1.200